Гаплогруппа Q (Y-ДНК)

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск


Гаплогруппа Q
[[Файл:|200px|]]
Тип Y-ДНК
Время появления 20000—15000 лет до н.э.
Место появления Сибирь или Урал
Предковая группа Гаплогруппа P
Субклады Индейцы
Мутации-маркеры M242
Преобладающие носители селькупы (70%), кеты (95%), коренные американцы (вплоть до 95%).
Haplogroup Q (Y-DNA).PNG

Гаплогруппа Q — Y-хромосомная гаплогруппа, распространённая у некоторых сибирских народов, а также у коренных американских народов, и, в некоторой степени — по всей Азии. Предполагается, что носителями данной гаплогруппы были имеющие сибирское происхождение гунны[1]. В Европе данная гаплогруппа распространена среди венгров (2 %) и словаков (5 %).

Подгруппы[править | править исходный текст]

Этногеографическое распределение[править | править исходный текст]

В Евразии встречается в пределах треугольника с вершинами в Норвегии (для скандинавских стран типична Q1a3 (M346)), Иране и Монголии. Но в основном среди всех этих народов встречается редко. Однако значительна у малочисленных сибирских народов кеты (95 %) и селькупы (70 %). Типична и для коренных американцев.

Мутации[править | править исходный текст]

Детали M242:

Смена нуклеотидов: от C к T
Позиция: 180
Общая величина: 366
Вперёд 5′→ 3′: aactcttgataaaccgtgctg
Назад 5′→ 3′: tccaatctcaattcatgcctc

Известные представители[править | править исходный текст]

Исследование ДНК Y-хромосомы представителей татарских князей Мансыревых и Дивеевых, имеющих общего предка по мужской линии, выявило у них гаплогруппу Q1b[5]. У мальчика Анзик-1 (Anzick-1), жившего 12,6 тысяч лет назад на территории нынешнего штата Монтана, Y-хромосома относится к субкладе Q-L54*(xM3) (en:Haplogroup Q-L54)[6][7][8].

См. также[править | править исходный текст]

Дерево гаплогрупп Y-ДНК человека (Гаплогруппы Y-ДНК по народам)

Y-хромосомный Адам
|
A BT
|
B CT
|
DE CF
| |
D E C
|
G IJK H
|
IJ
| |
I J LT K(xLT)
| | | |
I1 I2 J1 J2 L T M NO P S
| |
N O Q R
|
R1 R2
|
R1a R1b

Примечания[править | править исходный текст]

  1. Haplogroup Q (Y-DNA)
  2. Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture, " Nature 431, 302—305 (16 September 2004)
  3. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity, " Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
  4. "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas, " Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003
  5. Акчурин М. М. Родословные татарских князей из фонда Саровского монастыря // Этнологические исследования в Татарстане.- вып. V.- Казань, 2011.- С.118-153.
  6. M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.
  7. Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  8. Элементы — новости науки: Геном доисторического мальчика показал, что современные индейцы — прямые потомки кловисских охотников на мамонтов

Ссылки[править | править исходный текст]