Гаплогруппа Q (Y-ДНК)

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск

Гаплогруппа Q
Haplogroup Q (Y-DNA).PNG
Время появления 20000—15000 лет до н.э.
Место появления Сибирь или Урал
Предковая группа Гаплогруппа P
Субклады Индейцы
Мутации-маркеры M242
Преобладающие носители селькупы (70%), кеты (95%), коренные американцы (вплоть до 95%), челканцы (более 50%)

Гаплогруппа Q — Y-хромосомная гаплогруппа, распространённая у некоторых сибирских народов, а также у коренных американских народов, и, в некоторой степени — по всей Азии. Предполагается, что носителями данной гаплогруппы были имеющие сибирское происхождение гунны[1]. В Европе данная гаплогруппа распространена среди венгров (2 %) и словаков (5 %).

Подгруппы[править | править вики-текст]

Этногеографическое распределение[править | править вики-текст]

В Евразии встречается в пределах треугольника с вершинами в Норвегии (для скандинавских стран типична Q1a3 (M346)), Иране и Монголии. Но в основном среди всех этих народов встречается редко. Однако значительна у малочисленных сибирских народов кеты (95 %) и селькупы (70 %). Типична и для коренных американцев. Среди евреев-ашкеназы встречается субклад Q1b.

Мутации[править | править вики-текст]

Детали M242:

Смена нуклеотидов: от C к T
Позиция: 180
Общая величина: 366
Вперёд 5′→ 3′: aactcttgataaaccgtgctg
Назад 5′→ 3′: tccaatctcaattcatgcctc

Известные представители гаплогруппы Q[править | править вики-текст]

Интересные факты[править | править вики-текст]

У мальчика Анзик-1 (Anzick-1), жившего 12,6 тысяч лет назад на территории нынешнего штата Монтана, Y-хромосома относится к субкладе Q-L54*(xM3) (en:Haplogroup Q-L54)[6][7][8].

См. также[править | править вики-текст]

Y-хромосомный Адам
A00 A0’1'2’3'4
A0 A1’2'3’4
A1 A2’3'4
A2 A3 B CT 
D1 D2 E1 E2 C1 C2 G IJK H
| | | | | | | |
D1a D1b D1c E1a E1b E2a E2b C1a C1b C1c C2a C2b C2c C2d C2e C2f G1 G2 IJ K H1 H2 H3
| | |
I J L K(xLT) T H1a H1b H1c
| | | |
I1 I2 J1 J2 L1 L2 M NO P S
| | | | | | |
I1a I1b I2a I2b I2c J2a J2b L1a L1b L1c M1 M2 M3 N O Q R
| | | |
N1 O1 O2 O3 Q1 R1 R2
| | |
N1a N1b N1c Q1a Q1b R1a R1b
  1. van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2013). «Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome». Human Mutation. DOI:10.1002/humu.22468. PMID 24166809.

Примечания[править | править вики-текст]

  1. Haplogroup Q (Y-DNA)
  2. Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture, " Nature 431, 302—305 (16 September 2004)
  3. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity, " Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
  4. "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas, " Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003
  5. Акчурин М. М. Родословные татарских князей из фонда Саровского монастыря // Этнологические исследования в Татарстане.- вып. V.- Казань, 2011.- С.118-153.
  6. M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.
  7. Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  8. Элементы — новости науки: Геном доисторического мальчика показал, что современные индейцы — прямые потомки кловисских охотников на мамонтов

Ссылки[править | править вики-текст]