Гаплогруппа R1b (Y-ДНК)

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск

Гаплогруппа R1b
Распространенность гаплогруппы R1b
Распространенность гаплогруппы R1b
Время появления 16 500 лет до н. э.[1]
Место появления Западная Азия[2], Русская равнина[3] или Центральная Азия[3]
Предковая группа R1
Сестринские группы R1a
Мутации-маркеры M343
Преобладающие носители англичане, ассирийцы, баски, башкиры, бельгийцы, бретонцы, валийцы, голландцы, южные датчане , ирландцы, испанцы, северные и центральные итальянцы , камерунцы-мандара, кумандинцы, западные и центральные немцы, австрийцы, португальцы, французы, чехи силезские, швейцарцы, шотландцы

R1b — гаплогруппа, наиболее распространённая в Западной Европе и на Южном Урале. Встречается также в Центральной Азии, Восточной Европе, Северной Африке, Западной Азии. После миграций европейцев в Америку и Австралию она составляет значительную долю и там. Определяется однонуклеотидным полиморфизмом M343, открытым в 2004 году[4]. С 2001 по 2005 год R1b определяли наличием ОНП P25. В других системах классификации — Hg1 и Eu18.[5]

Происходит из R1, как и R1a.

Происхождение[править | править вики-текст]

Британские генетики Брайан Сайкс и Стивен Оппенгеймер утверждают, что гаплогруппа R1b не имеет отношения к индоевропейскому заселению Западной Европы и происходит от палеолитического (доиндоевропейского) населения Иберии (баски). Взгляды Сайкса и Оппенгеймера получили широкое распространение в Европе благодаря написанными им популярным бестселлерам о генетической истории Европы. С другой стороны, подобный взгляд на происхождение R1b сталкивается с непреодолимыми противоречиями. Последующие исследования установили, что разнообразие субкладов данной гаплогруппы увеличивается по мере движения на восток, что скорее говорит о восточном происхождении данной гаплогруппы[6]. Ряд современных генетиков полагают, что R1b зародилась в Центральной[7] или Западной Азии[8].

Сначала была выдвинута гипотеза, что R1b является коренной для Западной Европы, поскольку именно там она преобладает. Впоследствии было доказано, что гаплотипы R1b демонстрируют большее разнообразие малых побочных ответвлений в Анатолии и на Кавказе, чем в Европе. Однако известно что древние греки практически отождествляли население Кавказа (Иберия) и современной Испании (Пиренейский полуостров). Также европейские субклады более молоды по сравнению со средневосточными или центральноазиатскими. Основная западноевропейская ветвь R-P312/S116 восходит всего лишь к 3500 или 3000 до н. э., следовательно, старейший общий предок этой линии жил по крайней мере 5000 — 5500 лет назад в долине нижнего Дуная или в Причерноморье. В любом случае, эти временные рамки слишком малы для палеолитического происхождения или неолитического пришествия R1b. Открытие субкладов гаплогруппы R1b в Средней Азии, Пакистане и Индии окончательно опровергло её палеолитическое происхождение в Западной Европе и подтвердило её связь с индоевропейцами[9].

Этот вывод подтверждается дальнейшими исследованиями подгруппы R1b1a2, носителем которой возможно являлись фараоны Эхнатон и Тутанхамон. Она предположительно зародилась на Кавказе около 9500 лет назад — известно что до расселения семитов кавказские народы (урарты; хатты; хурриты; шумеры) были широко расселены по территории Ближнего Востока — и начали миграцию в Европу около 7000 лет назад (см. Балканский неолит). Часть её представителей мигрировала в Северную Африку[10] (примером массовой миграции из Ближнего Востока в Египет является нашествие гиксосов, которое имело место за пол тысячелетия до рождения Тутанхамона).

Проблема доминирования R1b в Западной Европе[править | править вики-текст]

Плотность распространения гаплогруппы R1b примерно совпадает с районами строительства мегалитов в Западной Европе. Это совпадение служит одним из оснований устаревшей гипотезы Сайкса и Оппенгеймера о сравнительно автохтонном палеоевропейском происхождении данной гаплогруппы. Согласно данной гипотезе, носители гаплогруппы R1b являются потомками Солютрейской культуры (хотя мегалиты появляются только через 9000 лет после её окончания), пережившими последний ледниковый максимум (ок. 20 тыс. лет назад) на Пиренейском полуострове в изоляции от других народов и ок. 10 тыс. лет (после таяния ледника) заселили Западную Европу[11].

Ряд более новых исследований[9] подвергают критике гипотезу Сайкса. В частности, предполагается, что R1b следует ассоциировать с индоевропейцами (в частности в более позднее время в Западной Европе — особенно с кельтами)[12], пришедшими из Причерноморья примерно 5000 лет назад (предполагается, что изначально также носители праиндоевропейской культуры с гаплогруппой R1a занимали преимущественно северную часть ареала, тогда как R1b — более южную, возможно, включающую Кавказ и Анатолию). Есть также мнение, что они не говорили на индоевропейских языках, а на неких, не уцелевших до нынешнего времени сино-кавказских языках, единственным осколком которых в Европе оказался баскский язык, перейдя впоследствии на индоевропейские языки и из-за субстратной лексики возникли кельтские языки, италийские языки.

При этом возникает некоторая сложность объяснения того, почему большинство современных мужчин Западной Европы оказываются потомками выходцев из Понтийского региона. Однако приводятся демографические выкладки, показывающие, что в случае установления гегемонии со стороны пришельцев, технологически превосходивших автохтонное население, мужские линии победителей могут полностью вытеснить мужскую линию наследственности местного населения за несколько веков. Значительная часть мужчин могла быть убита сразу в военных столкновениях, в дальнейшем же семьи местных мужчин получали более низкий статус и могли воспроизводить меньше детей. Со времени установления в Западной Европе господства кельтов до более лояльных времён Римской империи прошло примерно восемь веков, за которые автохтонные гаплогруппы вполне могли полностью исчезнуть. В Центральной и Восточной Европе ко времени вторжения индоевропейцев существовала более развитая земледельческая культура, поэтому в этих районах вытеснение старых гаплогрупп не было таким полным.

Подгруппы (субклады)[править | править вики-текст]


R-M18 (R1b1a)


R-M73 (R1b1b1)


R-U198 (R1b1b2a1a1)

R-S26 (R1b1b2a1a2)

R-L44 (R1b1b2a1a4)

R-U106* (R1b1b2a1a*)


R-M153 (R1b1b2a1b2)

R-M167 (R1b1b2a1b3)


R-L20 (R1b1b2a1b4c1)

R-L2* (R1b1b2a1b4c*)

R-U152* (R1b1b2a1b4*)

R-S68 (R1b1b2a1b5)


R-M222 (R1b1b2a1b6b)

R-L21* (R1b1b2a1b6*)

R-P312* (R1b1b2a1b*)

R-P310* (R1b1b2a1*)

R-P311* (R1b1b2a*)

R-M269* (R1b1b2*)

R-P297* (R1b1b*)

R-P25* (R1b1*)

R-M343* (R1b*)

Этногеографическое распределение[править | править вики-текст]

R1b показана красным
R1a показана пурпурным

Европа[править | править вики-текст]

Распределение Y-DNA гаплогрупп в Европе. Принцип пазлов — выделены территории, где частоты гаплогрупп составляют более трети генофонда (>35 %)

Современная концентрация R1b максимальна на территориях, связанных с кельтами: в южной Англии около 70 %, в северной и западной Англии, Уэльсе, Шотландии, Ирландии — до 90 % и более, в Испании — 70 %, во Франции — 60 %[10]. По-видимому она связана с докельтским субстратом, поскольку высока её концентрация и у не-кельтов басков — 88,1 %[13] и испанцев — 70 %[14]. Кроме того, известно, что, например, строителями Стоунхенджа в Англии было население, обитавшее на острове до прихода кельтов.

У соседних народов концентрация данной гаплогруппы падает: у итальянцев — 40 %[15], немцев — 39 %[16], норвежцев — 25,9 %[17] и других.

У народов Восточной Европы она встречается ещё реже. У чехов и словаков — 35,6 %[13], поляков — 11,6 %[18]-16,4 %[13], латышей — 15 %[19], венгров — 13,3 %[19], татар — 8,7 %[20], эстонцев — 9 %[19], литовцев — 5 %[19], белорусов — 4,2 %[20], русских — от 2,8 %[21] до 21,3 %[22], украинцев — от 2 %[13] до 18,9 %[23].

На Балканах — у греков — от 13,5 %[24] до 22,8 %[13], словенцев — 21 %[19], албанцев — 17,6 %[13], болгар — 17 %[25], хорватов — 15,7 %[26], румын — 13 %[23], сербов — 10,6 %[26], герцеговинцев — 3,6 %[26], боснийцев — 1,4 %[26].

Кавказ[править | править вики-текст]

На Кавказе найдена у осетин-дигорцев — по разным данным до 43 %[19] у армян — 32,4 %, азербайджанцев — 11 %[27][28]. Среди армян Сюника и Карабаха процент представителей гаплогруппы R1b выше — превышает 40 %[29].

Азия[править | править вики-текст]

За пределами Западной Европы высокая концентрация данной гаплогруппы встречается лишь у некоторых популяций башкир (бурзян, гайна и др.) — до 87 %[30], что, возможно, связано с присутствием дотюркского субстрата, а могут башкирские варианты, наоборот, быть исконной тюркской гаплогруппой, пришедшей из Азии. У башкир высокие показатели как M269, так и M73.

На Алтае гаплогруппа R1b (субклад R1b-M73)- встречается у кумандинцев — 49 %[31].

В Турции достигает 16 %[32], Ираке — 11,3 %[33] и в других странах Западной Азии. В Турции у турок — 31 %[34].

В Центральной Азии обнаружена, в частности, у туркменов — 37 %[35], узбеков — 9,8 %[35],, казахов — 5,6 %[35], уйгуров — от 8,2 %[36] до 19,4 %[37]

В Пакистане — 6,8 %[38], в Индии незначительна — 0,55 %[39].

Африка[править | править вики-текст]

У камерунцев-мандара до 65 %[40], у алжирских арабов из Орана — 10,8 %[41], тунисских арабов — 7 %[42], алжирских берберов — 5,8 %[43], в Марокко — около 2,5 %[44], у арабов Египта — менее 1 %[10].

Мутации[править | править вики-текст]

Детали M343 (rs9786184):

Смена нуклеотидов: от C к A
Позиция: 402
Общий размер: 424
Вперёд 5'? 3': tttaacctcctccagctctgca
Назад 5'? 3': acccccacatatctccagg

Интересные факты[править | править вики-текст]

На мультфильм Артёма Лукичева по мотивам башкирского эпоса об Урале, изложена история кластеров гаплогруппы R1: R1a и R1b[45].

Примечания[править | править вики-текст]

  1. Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree
  2. International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades
  3. 1 2 Anatoly A. Klyosov, Giancarlo T. Tomezzoli, "DNA Genealogy and Linguistics. Ancient Europe.", The Academy of DNA Genealogy, Newton, USA 2013. Vol.3, No.2, pp.101-111. doi:10.4236/aa.2013.32014
  4. Cinnioglu, Cengiz; et al (January 2004). «Excavating Y-chromosome haplotype strata in Anatolia». Human Genetics 114 (2): 127–148. DOI:10.1007/s00439-003-1031-4. Проверено 2007-12-13.
  5. Y Chromosome Consortium. YCC NRY Tree 2002 (en:2002-01-18). Проверено 13 декабря 2007. Архивировано из первоисточника 25 марта 2012.
  6. B. Arredi, E. S. Poloni and C. Tyler-Smith The peopling of Europe // Anthropological genetics: theory, methods and applications / Crawford, Michael H.. — Cambridge, UK: Cambridge University Press, 2007. — P. 394. — ISBN 0-521-54697-4.
  7. Variations of R1b Ydna in Europe: Distribution and Origins. Архивировано из первоисточника 25 марта 2012.
  8. International Society of Genetic Genealogy (ISOGG) — Y-DNA Haplogroup R and its Subclades — 2009
  9. 1 2 Origins, age, spread and ethnic association of European haplogroups and subclades (англ.). Eupedia, your guide to Europe in English (последнее обновление: март 2010). Проверено 5 апреля 2010. Архивировано из первоисточника 4 марта 2012.
  10. 1 2 3 Lenta.ru: Прогресс: Половина европейцев оказалась потомками египетских фараонов
  11. Ностратики, Y-хромосомы и неолитическая революция
  12. Гаплогруппы русских
  13. 1 2 3 4 5 6 Ornella Semino, A. Silvana Santachiara-Benerecetti, Francesco Falaschi, L. Luca Cavalli-Sforza and Peter A. Underhill, "Ethiopians and Khoisan Share the Deepest Clades of the Human Y-Chromosome Phylogeny, " The American Journal of Human Genetics, Volume 70, Issue 1, 265—268, 1 January 2002.
  14. 582/1002, The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula, Adams et al. 2008
  15. 280/699, Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter, Capelli et al. 2007
  16. 473/1215, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  17. [1] Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland — Agnar Helgason et al., 2000, Am. J. Hum. Genet. 67:697-717, 2000
  18. 106/913, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  19. 1 2 3 4 5 6 Oxford Journals
  20. Doron M. Behar, Mark G. Thomas, Karl Skorecki, Michael F. Hammer, Ekaterina Bulygina, Dror Rosengarten, Abigail L. Jones, Karen Held, Vivian Moses, David Goldstein, Neil Bradman, and Michael E. Weale, "Multiple Origins of Ashkenazi Levites: Y Chromosome Evidence for Both Near Eastern and European Ancestries, " American Journal of Human Genetics 73:768-779, 2003.
  21. Balanovsky
  22. Tambets et al., "«The Western and Eastern Roots of the Saami—the Story of Genetic 'Outliers' Told by Mitochondrial DNA and Y Chromosomes»", American Journal of Human Genetics Т. 74: 661–682, doi:10.1086/383203, <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1181943/> 
  23. 1 2 Alexander Varzari, «Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms» (2006)
  24. R. J. King, S. S. Özcan, T. Carter, E. Kalfoğlu, S. Atasoy, C. Triantaphyllidis, A. Kouvatsi, A. A. Lin, C-E. T. Chow, L. A. Zhivotovsky, M. Michalodimitrakis, P. A. Underhill (2008), "Differential Y-chromosome Anatolian Influences on the Greek and Cretan Neolithic, " Annals of Human Genetics 72 (2), 205—214 doi:10.1111/j.1469-1809.2007.00414.x
  25. Rosser et al. (2000)
  26. 1 2 3 4 Pericic, M; Lauc LB, Klaric IM, Rootsi S, Janicijevic B, Rudan I, Terzic R, Colak I, Kvesic A, Popovic D, Sijacki A, Behluli I, Dordevic D, Efremovska L, Bajec DD, Stefanovic BD, Villems R, Rudan P (2005). «High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations». Mol. Biol. Evol. 22 (10): 1964–75. DOI:10.1093/molbev/msi185. PMID 15944443. Haplogroup frequency data in table 1
  27. 238/734, Weale et al. (2004)
  28. : Geographic spread and ethnic origins of European haplogroups
  29. Family Tree DNA — Armenian DNA Project
  30. Лобов А. С. (2009) «Структура генофонда субпопуляций башкир» (автореферат диссертации)
  31. Балаганская О. А. Полиморфизм Y-хромосомы у тюркоязычного населения Алтая, Саян, Тянь-Шаня и Памира в контексте взаимодействия генофондов Западной и Восточной Евразии // Автореферат кандидатской диссертации по биологическим наукам. М., МГНЦ РАМН, 2011, С.10.
  32. 76/523, Y-Chromosome Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al. 2004
  33. 16/139, Zaheri et al. 2003,Y-chromosome and mtDNA polymorphisms in Iraq
  34. Nasidze et al. (2004)
  35. 1 2 3 R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity, " Proceedings of the National Academy of Sciences of the United States of America (en:August 28, en:2001)
  36. Ruixia Zhou, Daqun Yang, Hua Zhang, Weiping Yu, Lizhe An, Xilong Wang, Hong Li, Jiujin Xu, and Xiaodong Xie, "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape, " Annals of Human Biology (2008), 35:2, 198—211.
  37. Yali Xue, Tatiana Zerjal, Weidong Bao, Suling Zhu, Qunfang Shu, Jiujin Xu, Ruofu Du, Songbin ***, Pu Li, Matthew E. Hurles, Huanming Yang, Chris Tyler-Smith, "Male demography in East Asia: a north-south contrast in human population expansion times, " Genetics 2006.
  38. Qamar et al. (2002), Cruciani et al. (2004), Semino et al. (2004), Underhill et al. (2000)
  39. 13/176 in Pakistan and 4/728 in India, Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists, Sengupta et al. 2008
  40. Wood et al. 2005
  41. 11/102, Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample
  42. 10/139 Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula , Adams et al. 2008
  43. 3/54 Arredi et al. 2004
  44. Combined Adams et al. 2008; Bosch et al. 2001 and Maria Brotilini et al. 2004
  45. About R1a and R1b from Ural epic story. Artem Lukichev (c)

Ссылки[править | править вики-текст]

Y-хромосомный Адам
A00 A0’1'2’3'4
A0 A1’2'3’4
A1 A2’3'4
A2 A3 B CT 
D1 D2 E1 E2 C1 C2 G IJK H
| | | | | | | |
D1a D1b D1c E1a E1b E2a E2b C1a C1b C1c C2a C2b C2c C2d C2e C2f G1 G2 IJ K H1 H2 H3
| | |
I J L K(xLT) T H1a H1b H1c
| | | |
I1 I2 J1 J2 L1 L2 M NO P S
| | | | | | |
I1a I1b I2a I2b I2c J2a J2b L1a L1b L1c M1 M2 M3 N O Q R
| | | |
N1 O1 O2 O3 Q1 R1 R2
| | |
N1a N1b N1c Q1a Q1b R1a R1b
  1. van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2013). «Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome». Human Mutation. DOI:10.1002/humu.22468. PMID 24166809.