Метод дробовика

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск

Метод дробовика (англ. Shotgun sequencing или шотган-секвенирование/клонирование) — метод, используемый для секвенирования длинных участков ДНК. Суть метода состоит в получении случайной массированной выборки клонированных фрагментов ДНК данного организма, на основе которых может быть составлена его геномная библиотека.

Поскольку обычные методы секвенирования могут быть применимы только к коротким отрезкам ДНК (100-1000 пар оснований), более длинные последовательности можно разделить на фрагменты, а затем собрать заново, чтобы получить полную последовательность большого участка ДНК. Для этого используются два основных метода: хромосомная ходьба (англ. chromosome walking), который позволяет определить шаг за шагом последовательность большого участка ДНК, и данный метод, который намного быстрее, но и сложнее, так как используются случайные фрагменты ДНК, которые затем необходимо собрать вместе (с помощью специального программного обеспечения).

При секвенировании методом дробовика ДНК случайным образом фрагментируется на мелкие участки, которые затем секвенируют обычными методами, например, методом Сэнгера. Полученные перекрывающиеся случайные фрагменты ДНК затем собирают с помощью специальных программ в одну целую большую последовательность, однако, при сборке некоторые затруднения представляют повторенные последовательности ДНК.

Метод дробовика применяли для получения первых полных геномов организмов.

Пример[править | править вики-текст]

Для примера, допустим, что имеются два случайных фрагмента, полученных методом дробовика:

Цепь Последовательность
Первоначальная AGCATGCTGCAGTCATGCTTAGGCTA
Первый фрагмент AGCATGCTGCAGTCATGCT-------
-------------------TAGGCTA
Второй фрагмент AGCATG--------------------
------CTGCAGTCATGCTTAGGCTA
Восстановленная последовательность AGCATGCTGCAGTCATGCTTAGGCTA

Наиболее часто используемой программой для сборки полученных ДНК-фрагментов в единое целое является программа Phred.

Ссылки[править | править вики-текст]