Гаплогруппа Q (Y-ДНК)

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск
Гаплогруппа Q
Haplogroup Q (Y-DNA).PNG
Тип Y-ДНК
Время появления 20000—15000 лет до н.э.
Место появления Сибирь или Урал
Предковая группа Гаплогруппа P
Субклады Индейцы
Мутации-маркеры M242

Гаплогруппа Q — Y-хромосомная гаплогруппа, распространённая у некоторых сибирских народов, а также у коренных американских народов, и, в некоторой степени — по всей Азии. Предполагается, что носителями данной (и других) гаплогруппы были имеющие сибирское происхождение гунны[1]. В Европе данная гаплогруппа распространена среди венгров[источник не указан 865 дней] (2 %) и словаков[источник не указан 865 дней] (5 %), в южной Швеции (5 %), среди евреев ашкеназов (5 %), и в некоторых районах Центральной и Восточной Европы (французские Альпы, южная Сицилия, южная Хорватия (до 6,1 % на острове Хвар), Сербия, части Польши и Украины, часть северо-западной России с центром в Тверской области)[2].

Гаплогруппа Q образовалась от субклады P1 (M45), известной как K2b2a, гаплогруппы P (K2b2) 31,9 тыс. лет назад. Последний общий предок современных носителей гаплогруппы Q жил 29,600 лет назад (датировка по SNP-маркёрам (снипам), по данным компании YFull[3]).

Взрывообразный рост числа потомков основателя субклады Q1a-M3 произошёл примерно 15 тыс. лет назад в Новом Свете, когда потомки мужчины-основателя группы стали очень быстро расселяться по огромным незаселённым просторам обеих Америк[4][5].

Этногеографическое распределение[править | править вики-текст]

В Евразии встречается в пределах треугольника с вершинами в Норвегии (для скандинавских стран типична Q1a3 (M346)), Иране и Монголии. Но в основном среди всех этих народов встречается редко. Однако значительна у малочисленных сибирских народов кетов (95 %) и селькупов (70 %). Гаплогруппа Q доминирует у туркмен Каракалпакстана — 73 %, туркмен Ирана — 43 %, туркмен Афганистана — 34 %[6]. Субклада Q1a3a (M3) типична для коренных американцев. Среди евреев-ашкеназов встречается субклад Q1b.

Мутации[править | править вики-текст]

Детали M242:

Смена нуклеотидов: от C к T
Позиция: 180
Общая величина: 366
Вперёд 5′→ 3′: aactcttgataaaccgtgctg
Назад 5′→ 3′: tccaatctcaattcatgcctc

Известные представители гаплогруппы Q[править | править вики-текст]

Палеогенетика[править | править вики-текст]

  • Гаплогруппа Q1a была обнаружена у представителя палеоэскимосской культуры Саккак, жившего в Гренландии ок. 4 тыс. лет назад[8].
  • У мальчика Анзик-1 (en:Anzick-1), жившего 12,6 тысяч лет назад на территории нынешнего штата Монтана, Y-хромосома относится к субкладе Q1a3a-L54*(xM3) (en:Haplogroup Q-L54)[9][10][11].
  • Субклада Q1a3a-M3 была обнаружена у кенневикского человека, жившего 9300 лет назад[12].
  • Субклада Q1a2 обнаружена у мезолитического обитателя стоянки Звейниеки (Латвия)[13].
  • Субклада Q1a была обнаружена у представителя хвалынской культуры, жившего 6700 лет назад[14].
  • Субклада Q1a3 обнаружена у обитателей позднего неолита—ранней бронзы стоянки Усть-Ида и обитателей ранней бронзы стоянки Курма XI в Прибайкалье[15].
  • Гаплогруппа Q обнаружена у двух мужчин из захоронения среднего бронзового века в Бертек 56 на плато Укок на Алтае[16].
  • Y-хромосомная гаплогруппа Q1a была обнаружена у представителя карасукской культуры[17].
  • Все четыре мужчины хунну из Pengyang в Северном Китае, жившие 2500 лет назад, оказались обладателями Y-хромосомной гаплогруппы Q (у всех субклада Q1a1a1-M120)[18][19].
  • У представителя усть-бельской культуры со стоянки Усть-Белая II (4410 — 4100 лет до настоящего времени) и у древний алеутов с Алеутских островов (от 2320—1900 до 500—140 л. н.) определена субклада Q1a2a, у образца I1524 (1180 — 830 л. н.) из Уэлена (Чукотка) определена субклада Q1a2a1a1[20].

См. также[править | править вики-текст]

п о р Эволюционное древо гаплогрупп Y-хромосомы человека
Y-хромосомный Адам
A00 A0-T
A0 A1
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1 F2 F3 GHIJK
G HIJK
H IJK
IJ K
I J LT (K1) K2
L (K1a) T (K1b) K2a/K2a1/NO/NO1 K2b
N O K2b1 P (K2b2)/P1
S (K2b1a) M (K2b1b) Q R


Примечания[править | править вики-текст]

  1. Haplogroup Q (Y-DNA)
  2. Haplogroup Q (Y-chromosomal DNA) — Eupedia
  3. Q YTree
  4. Poznik et al. Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences, 2016
  5. Генетики обнаружили пять древних отцов всего человечества
  6. Генофонд туркмен Каракалпакстана в контексте Центральной Азии
  7. Акчурин М. М. Родословные татарских князей из фонда Саровского монастыря // Этнологические исследования в Татарстане.- вып. V.- Казань, 2011.- С.118-153.
  8. Rasmussen, M. et al., «Ancient human gonome sequence of an extinct Palaeo-Eskimo». Nature 463: 757—762.
  9. Rasmussen M. et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225—229.
  10. Jennifer A. Raff, Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162—163.
  11. Элементы — новости науки: Геном доисторического мальчика показал, что современные индейцы — прямые потомки кловисских охотников на мамонтов
  12. The ancestry and affiliations of Kennewick Man /Nature (2015)
  13. Iain Mathieson et al. The Genomic History Of Southeastern Europe, 2017
  14. Iain Mathieson et al. Eight thousand years of natural selection in Europe, 2015
  15. Maternal and Paternal Polymorphisms in Prehistoric Siberian Populations of Lake Baikal (2015)
  16. Пилипенко А. С., Молодин В. И., Трапезов Р. О., Черданцев С. В., Журавлёв А. А. Молекулярно-генетический анализ останков людей из погребального комплекса эпохи бронзы Бертек-56 (II тыс. до н. э., Республика Алтай, Россия) // Археология, этнография и антропология Евразии. Том 44 № 4 2016
  17. Morten E. Allentoft et al. «Population genomics of Bronze Age Eurasia»
  18. Ancient DNA from nomads in 2500-year-old archeological sites of Pengyang, Ningxia, China. Journal of Human Genetics, Feb 2010
  19. All 4 was analyzed as Q1a1a1-M120. Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  20. Pavel Flegontov et al. Paleo-Eskimo genetic legacy across North America, 2017

Ссылки[править | править вики-текст]