Гаплогруппа Q (Y-ДНК)

Материал из Википедии — свободной энциклопедии
Перейти к: навигация, поиск

Гаплогруппа Q
Haplogroup Q (Y-DNA).PNG
Время появления 20000—15000 лет до н.э.
Место появления Сибирь или Урал
Предковая группа Гаплогруппа P
Субклады Индейцы
Мутации-маркеры M242
Преобладающие носители селькупы (70%), кеты (95%), коренные американцы (вплоть до 95%), челканцы (более 50%)

Гаплогруппа Q — Y-хромосомная гаплогруппа, распространённая у некоторых сибирских народов, а также у коренных американских народов, и, в некоторой степени — по всей Азии. Предполагается, что носителями данной (и других) гаплогруппы были имеющие сибирское происхождение гунны[1]. В Европе данная гаплогруппа распространена среди венгров[источник не указан 459 дней] (2 %) и словаков[источник не указан 459 дней] (5 %), в южной Швеции (5%), среди евреев ашкеназов (5%), и в некоторых районах Центральной и Восточной Европы (французские Альпы, южная Сицилия, южная Хорватия (до 6.1% на острове Хвар), Сербия, части Польши и Украины)[2].

Взрывообразный рост числа потомков основателя субклады Q1a-M3 произошёл примерно 15 тыс. лет назад в Новом Свете, когда потомки мужчины-основателя группы стали очень быстро расселяться по огромным незаселённым просторам обеих Америк[3][4].

Подгруппы[править | править вики-текст]

Этногеографическое распределение[править | править вики-текст]

В Евразии встречается в пределах треугольника с вершинами в Норвегии (для скандинавских стран типична Q1a3 (M346)), Иране и Монголии. Но в основном среди всех этих народов встречается редко. Однако значительна у малочисленных сибирских народов кетов (95 %) и селькупов (70 %). Типична и для коренных американцев. Среди евреев-ашкеназов встречается субклад Q1b.

Мутации[править | править вики-текст]

Детали M242:

Смена нуклеотидов: от C к T
Позиция: 180
Общая величина: 366
Вперёд 5′→ 3′: aactcttgataaaccgtgctg
Назад 5′→ 3′: tccaatctcaattcatgcctc

Известные представители гаплогруппы Q[править | править вики-текст]

Интересные факты[править | править вики-текст]

  • Гаплогруппа Q1a была обнаружена у представителя палеоэскимосской культуры Саккак, жившего в Гренландии ок. 4 тыс. лет назад[9].
  • У мальчика Анзик-1 (en:Anzick-1), жившего 12,6 тысяч лет назад на территории нынешнего штата Монтана, Y-хромосома относится к субкладе Q1a3a-L54*(xM3) (en:Haplogroup Q-L54)[10][11][12].
  • Все четыре мужчины хунну из Pengyang в Северном Китае, жившие 2500 лет назад, оказались обладателями Y-хромосомной гаплогруппы Q-M242 (все Q1a1-M120)[13][14].
  • Y-хромосомная гаплогруппа Q1a была обнаружена у представителя карасукской культуры[15].
  • Гаплогруппа Q-M3 была обнаружена у кенневикского человека, жившего 9300 лет назад[16].
  • Субклада Q1a была обнаружена у представителя хвалынской культуры, жившего 6700 лет назад[17].
  • Субклада Q1a3 обнаружена у обитателей позднего неолита—ранней бронзы стоянки Усть-Ида и обитателей ранней бронзы стоянки Курма XI в Прибайкалье[18].

См. также[править | править вики-текст]

п о р Эволюционное древо гаплогрупп Y-хромосомы человека
Y-хромосомный Адам
A00 A0-T
A0 A1
A1a A1b
A1b1 BT

Примечания[править | править вики-текст]

  1. Haplogroup Q (Y-DNA)
  2. Haplogroup Q (Y-chromosomal DNA) - Eupedia
  3. Poznik et al. Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences, 2016
  4. Генетики обнаружили пять древних отцов всего человечества
  5. Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture, " Nature 431, 302—305 (16 September 2004)
  6. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity, " Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
  7. "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas, " Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003
  8. Акчурин М. М. Родословные татарских князей из фонда Саровского монастыря // Этнологические исследования в Татарстане.- вып. V.- Казань, 2011.- С.118-153.
  9. Rasmussen, M. et al., «Ancient human gonome sequence of an extinct Palaeo-Eskimo». Nature 463: 757–762.
  10. M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.
  11. Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  12. Элементы — новости науки: Геном доисторического мальчика показал, что современные индейцы — прямые потомки кловисских охотников на мамонтов
  13. Ancient DNA from nomads in 2500-year-old archeological sites of Pengyang, Ningxia, China. Journal of Human Genetics, Feb 2010
  14. All 4 was analyzed as Q1a1a1-M120. Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  15. Morten E. Allentoft, Martin Sikora, Karl-Göran Sjögren, Simon Rasmussen, Morten Rasmussen, Jesper Stenderup, Peter B. Damgaard, Hannes Schroeder, Torbjörn Ahlström, Lasse Vinner, Anna-Sapfo Malaspinas, Ashot Margaryan, Tom Higham, David Chivall, Niels Lynnerup, Lise Harvig, Justyna Baron, Philippe Della Casa, Paweł Dąbrowski, Paul R. Duffy, Alexander V. Ebel, Andrey Epimakhov, Karin Frei, Mirosław Furmanek, Tomasz Gralak et al. «Population genomics of Bronze Age Eurasia»
  16. The ancestry and affiliations of Kennewick Man /Nature (2015)
  17. Iain Mathieson et al. Eight thousand years of natural selection in Europe, 2015
  18. Maternal and Paternal Polymorphisms in Prehistoric Siberian Populations of Lake Baikal (2015)

Ссылки[править | править вики-текст]